View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_low_19 (Length: 224)
Name: NF2381_low_19
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 107 - 204
Target Start/End: Original strand, 35528235 - 35528332
Alignment:
| Q |
107 |
gtggtgctacagccaagatgttcctaaatgatactctacactaagattagttactcatgtcaaaccctaatttcctaagagtgtttttctttctttct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35528235 |
gtggtgctacagccaagatgttcctaaacgataccctacactaagactagttactcatgtcaaaccctaatttcctaagagtgtttttctttctttct |
35528332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 107 - 213
Target Start/End: Original strand, 35542730 - 35542836
Alignment:
| Q |
107 |
gtggtgctacagccaagatgttcctaaatgatactctacactaagattagttactcatgtcaaaccctaatttcctaagagtgtttttctttctttctac |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || || | ||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
35542730 |
gtggtgctacagccaagatgctcctaaatgatacccttcattgagactagttactcatgtcaaaccttaatttcctaagagtgattttctttctttctac |
35542829 |
T |
|
| Q |
207 |
tctaagt |
213 |
Q |
| |
|
||||||| |
|
|
| T |
35542830 |
tctaagt |
35542836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University