View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2381_low_2 (Length: 455)

Name: NF2381_low_2
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2381_low_2
NF2381_low_2
[»] chr3 (1 HSPs)
chr3 (375-447)||(34899903-34899975)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 9e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 375 - 447
Target Start/End: Complemental strand, 34899975 - 34899903
Alignment:
375 atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcatctc 447  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
34899975 atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctc 34899903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University