View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_low_6 (Length: 318)
Name: NF2381_low_6
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 75 - 222
Target Start/End: Original strand, 8773710 - 8773857
Alignment:
| Q |
75 |
aggagcagagagagaggtagcagaattgtagcagtgttgtgaaccacatcaacccaacaaggctaacagaaacattagaggaaagaagaaagcaacaatc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8773710 |
aggagcagagagagaggtagcagaattgtagcagtgttgtgaaccacatcaacccaacaaggctaacagaaacattagaggaaagaagaaagcaacaatc |
8773809 |
T |
 |
| Q |
175 |
ttttctgtgaatcattaaatgcagtaaacggaatgagagagattgatc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8773810 |
ttttctgtgaatcattaaatgcagtaaacggaatgagagagattgatc |
8773857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 48597662 - 48597617
Alignment:
| Q |
108 |
gtgttgtgaaccacatcaacccaacaaggctaacagaaacattaga |
153 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
48597662 |
gtgttgtgatcgacatcaacccaacaaggctaactgaaacattaga |
48597617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University