View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_low_8 (Length: 296)
Name: NF2381_low_8
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 46 - 237
Target Start/End: Complemental strand, 5405638 - 5405446
Alignment:
| Q |
46 |
ttgaagaatatttgaatgtatttaatgctagtttttattatgaattgtaaaccaagtagccagagtaagtaggagctaaattgttcctagaactaggatc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5405638 |
ttgaagaatatttgaatgtatttaatgctagtttttattatgaattgtaaaccaagtagccagagtaagtaggagctaaatttttcctagaactaggatc |
5405539 |
T |
 |
| Q |
146 |
tttatgctttttataaggacacataatcataca-ggaaaatttgtcacaagcttgtaacaatatgtactgttagaagtatttcaagattctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5405538 |
tttatgctttttataaggacacataatcatatatggaaaatttgtcacaagcttgtaacaatatgtactgttagaagtatttcaagattctct |
5405446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University