View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2382_high_5 (Length: 279)

Name: NF2382_high_5
Description: NF2382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2382_high_5
NF2382_high_5
[»] chr4 (1 HSPs)
chr4 (109-155)||(196577-196623)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 109 - 155
Target Start/End: Complemental strand, 196623 - 196577
Alignment:
109 tgatagtcaaaattactaaacaaattcagtttgattgttttctttct 155  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||    
196623 tgatagtcaaaattacgaaacaaattcagtttgattgttttctttct 196577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University