View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2382_high_7 (Length: 249)
Name: NF2382_high_7
Description: NF2382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2382_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 7567682 - 7567467
Alignment:
| Q |
18 |
acaatgtgatatataaagtaatgcatgtttgaatctgggcactcaatctccatatatgttaattgtcacaagaatttatactgtagaagatggatgtgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7567682 |
acaatgtgatatataaagtaatgcatgtttgaatatgggcactcaatctccatatatgttaattgtcacaagaatttatactgtaga---tggatgtgtc |
7567586 |
T |
|
| Q |
118 |
attgtcttgcatgcacaatgccatgtggttagtctcgatcgccaacttggtcttagggtcccctccttaactacatgatagatatccaagatcgattttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7567585 |
attgtcttgcatgcacaatgccatgtggttagtctcgatcgccaacttggtcttagggtcccctccttaactacatgatagatatccaagatcgattttc |
7567486 |
T |
|
| Q |
218 |
catttttcctctttctcct |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7567485 |
catttttcctctttctcct |
7567467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University