View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2383_high_2 (Length: 376)
Name: NF2383_high_2
Description: NF2383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2383_high_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 13 - 376
Target Start/End: Original strand, 3233905 - 3234269
Alignment:
| Q |
13 |
catcacacacccttaattgaattctcttgtattataaa-ctgcatcttccttgttaaacatcatcaccccttctcttgcaagctaccaccgaactccctt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3233905 |
catcgcacacccttaattgaattctcttgtattataaaactgcatcttccttgttaaacatcgtcaccccttctcttgcaagctaccaccgaactccctt |
3234004 |
T |
 |
| Q |
112 |
cctcccataatttgaactcccctagacagtgtcagttaacggcaacgtcaacggcgatggtgatagtgacaccggagatggagagaatgatagcaacgac |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234005 |
cttcccataatttgaactcccctagacagtgtcagttaacgacaacgtcaacggcgatggtgatagtgacaccggagatggagagaatgatagcaacgac |
3234104 |
T |
 |
| Q |
212 |
gtatgatggtggcagccttatgtagttgtgtgtgacaacgacaataataatgtcggcagcgactgacaacaatgatgtaaagtacaacaactacgtcgaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234105 |
gtatgatggtggcagccttatgtagttgtgtgtgacaacgacaataataatgtcggcagcgactgacaacaatgatgtaaagtacaacaactacgtcgaa |
3234204 |
T |
 |
| Q |
312 |
ggcaagttgttgtagcttagttttgagatgttgattgcggcaccaatgttgctatgtaggtggtt |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234205 |
ggcaagttgttgtagcttagttttgagatgttgattgcggcaccaatgttgctatgtaggtggtt |
3234269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 79 - 111
Target Start/End: Original strand, 45243259 - 45243291
Alignment:
| Q |
79 |
cccttctcttgcaagctaccaccgaactccctt |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45243259 |
cccttctcttgcacgctaccaccgaactccctt |
45243291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University