View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2383_low_4 (Length: 244)
Name: NF2383_low_4
Description: NF2383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2383_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 30684006 - 30684221
Alignment:
| Q |
16 |
atcacttcgtttcaagttgacgccaaaactgggtcggtcagtacaaatagtaagaattttgctgctcttcgaaatttaaatgcatcaaagccactgctga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30684006 |
atcacttcgtttcaagttgacgccaaaactgggtcggtcagtacaaatagtaagaattttgctggtcttcgaaatttaaatgcatcaaagccgctgctga |
30684105 |
T |
 |
| Q |
116 |
tcaatatttataggaaagatctttttctgaagtatgatggtccctcgtcgggatcaggattttggaatttgacagtagccgagtttgatgcagtgttatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30684106 |
tcaatatttataggaaagatctttttctgaagtatgatggtcccacgtcgggatcaggattttggaatttgacagtagccgagttcgatgcagtgttatt |
30684205 |
T |
 |
| Q |
216 |
atgccaacatataact |
231 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
30684206 |
atgccaacatttaact |
30684221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University