View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2384_high_3 (Length: 240)
Name: NF2384_high_3
Description: NF2384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2384_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 5947099 - 5946877
Alignment:
| Q |
1 |
acagatgagttgagcgagcttctcagttcttctccctctccggacgacgtttgaacttctgcaaaacggcaccgttatgtctttaattcaagccaatctt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5947099 |
acagatgagttgagcgagcttctgagttcttctccctctccggacgacgtttgaacttctgcaaaacggcaccgttatgtctttaattcaagccaatctt |
5947000 |
T |
 |
| Q |
101 |
ctacccaacttgtccttcaaccattttcaggttagcatcttccaaactttaattatttaccgtctgggtttcttcaatactctttcttaaacccacttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5946999 |
ctacccaacttgtccttcaaccattttcaggttagcatcttccaaactttaattatttaccgtctgggtttcttcaatactctttcttaaacccacttta |
5946900 |
T |
 |
| Q |
201 |
catttttcattaattcatagcatat |
225 |
Q |
| |
|
|| ||||||||||||||| ||||| |
|
|
| T |
5946899 |
ca--tttcattaattcataccatat |
5946877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University