View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2384_low_4 (Length: 247)
Name: NF2384_low_4
Description: NF2384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2384_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 42 - 232
Target Start/End: Complemental strand, 34909298 - 34909103
Alignment:
| Q |
42 |
acaaccat-tttaattaatgagtttggtcttgtacaaaaatctaatatgtagtgttaaagcttaaagtttatcaannnnnnncacaatttaatccttgat |
140 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| | |||||||||||||||||| |
|
|
| T |
34909298 |
acaaccatgtttaattaatgagtttggtcttgtacaaaaatctaatatgtagtgttaaaccttaaaatttatctatttttttcacaatttaatccttgat |
34909199 |
T |
 |
| Q |
141 |
atcttcttcaataaaaatttaatcaaaaatatctat----gtcatttcatatttattggtttaacctctaatttgaattcaatcaatcggtttatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909198 |
atcttcttcaataaaaatttaatcaaaaatatctatttatgtcatttcatattcattggtttaacctctaatttgaattcaatcaatcggtttatc |
34909103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University