View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2384_low_7 (Length: 215)
Name: NF2384_low_7
Description: NF2384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2384_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 39390593 - 39390777
Alignment:
| Q |
16 |
atcaataatggttctgaaagttgcaatttccttaacgtgtgcttgaatgagaggatgttttgagttaatgtaatttttagagaaaattcnnnnnnnntta |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| || || |||||||||||||||||||||| |||| |||||||||||||||||| | |
|
|
| T |
39390593 |
atcaataatgtttctgaaagttgcaattttcttaaagtatgtttgaatgagaggatgttttgaggtaatctaatttttagagaaaattaaaaaaaaaaaa |
39390692 |
T |
|
| Q |
116 |
aataaatttcattgttccgatggtaatttggagaatttcaaatgaaaatctaaaagataggaattacaaatcttttcattaatttt |
201 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39390693 |
aaaaaatttcattgttccaatggtaatttggagaatttcaaatgaaa-tctaaaagataggaattacaaatcttttcattaatttt |
39390777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 104
Target Start/End: Complemental strand, 31189466 - 31189414
Alignment:
| Q |
52 |
gtgtgcttgaatgagaggatgttttgagttaatgtaatttttagagaaaattc |
104 |
Q |
| |
|
||||| ||||||||||| |||||||||| ||||||||| ||| |||| ||||| |
|
|
| T |
31189466 |
gtgtgtttgaatgagagaatgttttgaggtaatgtaatgttttgagagaattc |
31189414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University