View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2385_low_16 (Length: 258)
Name: NF2385_low_16
Description: NF2385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2385_low_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 17224833 - 17224594
Alignment:
| Q |
19 |
tgtgtggaattgagctgaatccccttattaacggaattaatcggttgttgtataattagactctcatgttggatagttctatttctatcatcatagttaa |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17224833 |
tgtgtagaattgagctgaatccccttattaattgaattagtcggttgtcgtataattagactctcatgttggatagttctatttctatcatcatagttaa |
17224734 |
T |
|
| Q |
119 |
aataatatttcgatctgaagttctttatcttatgtttctgatgtattgttcgctttagatcatatgtgacaccacaattttctcatttgaaacaaaaatc |
218 |
Q |
| |
|
|||||| |||||| || |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
17224733 |
aataatgtttcgacctaaagttctttatcttgtgtttctgatgtattattcgctttagatcatatgtgacaccacaattttctcatttaaaacaaaagtc |
17224634 |
T |
|
| Q |
219 |
ttattgaattgatgagcatggatattgtctataaactctt |
258 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
17224633 |
ttattaaattgatgagcatgagtattgtctataaactctt |
17224594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University