View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2385_low_17 (Length: 243)
Name: NF2385_low_17
Description: NF2385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2385_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 50407456 - 50407250
Alignment:
| Q |
22 |
cacagaccattgcattagtatcacaattttttgctgcagactctttcacttcttgatcagttactattttaaccgaaaatggatcaacaaatgcaagctt |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
50407456 |
cacaaaccattgcattagtatcacaattttttgctgcagactctttcacttcttgatcagttactattttaactgaaaatggatcgacaaatgcaagctt |
50407357 |
T |
 |
| Q |
122 |
ttgactctttttctgttcaacaaagacaacagcaagaggtaggaacagcaaaattagaacaactgaagcacttccaatatactcactctgtttaaaagac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407356 |
ttgactctttttctgttcaacaaagacaacagcaagaggtaggaacagcaaaattagaacaactgaagcacttccaatatactcactctgtttaaaagac |
50407257 |
T |
 |
| Q |
222 |
acttttt |
228 |
Q |
| |
|
||||||| |
|
|
| T |
50407256 |
acttttt |
50407250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University