View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2385_low_19 (Length: 234)
Name: NF2385_low_19
Description: NF2385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2385_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 37124913 - 37125097
Alignment:
| Q |
17 |
aggaaaaactaaaacgaaaataaacaaggaaaatggaaacagtagaaatgagtgggtattatttgaactgagaacatgttaagaaagagtttgct-tgtt |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37124913 |
aggaaaaactaaaacaaaaataaacaaggaaaatggaaacagtagaaatgagtgggtattatttgaactgagaacatgttaagaaagagtttgctatgtt |
37125012 |
T |
 |
| Q |
116 |
ttatttggttacatgaaaagtgaaaggatatatagtaaaattttatgaaatatttttctttcttgttataaaatgagataaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37125013 |
ttatttggttacatgaaaagtgaaaggatatatagtaaaattttatgaaatatttttctttcttgttataaaatgagaaaaaaaa |
37125097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University