View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2386_low_12 (Length: 214)
Name: NF2386_low_12
Description: NF2386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2386_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 35293941 - 35293738
Alignment:
| Q |
1 |
aaactaaactaccaaataatattccatttttctttaactttttctaatctctactgttacttcattcatctaagttgcaagaaattcttcttgttttgca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293941 |
aaactaacctaccaaataatattccatttttctttatctttttctaatctctactgttacttcattcatctaagttgcaagaaattcttcttgttttgca |
35293842 |
T |
 |
| Q |
101 |
atggcaaacaatgaagaacagaaacatgcattgaaggacaagttgaaggaacttgcgaatactatagtggaaggtgatgacttcactgtgcatgctgctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293841 |
atggcaaacaatgaagaacagaaacatgcattgaaggacaagttgaaggaacttgtgaatactatagtggaaggtgatgacttcactgtgcatgctgctg |
35293742 |
T |
 |
| Q |
201 |
atga |
204 |
Q |
| |
|
|||| |
|
|
| T |
35293741 |
atga |
35293738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University