View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2386_low_3 (Length: 300)
Name: NF2386_low_3
Description: NF2386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2386_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 1228500 - 1228329
Alignment:
| Q |
7 |
tatactatatgcaaagtttagtagtattgtgataaagaattgatttattttgattctataagaattaaaatcattgatgaaatatattgtgatcaaagtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1228500 |
tatactatatgcaaagtttagtagtattgtgataaagaattgatttattttgattctataagagttaaaatcattgatgaaaaatattgtgatcaaagtt |
1228401 |
T |
|
| Q |
107 |
aaaagtttaattttcttttataaagattaaaaatcagtttttataggactaaaatatatttaactatatttt |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1228400 |
aaaattttaattttcttttataaagattaaaaatcagtttttataggactaaaatatatttaactatatttt |
1228329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 175 - 284
Target Start/End: Complemental strand, 1228269 - 1228160
Alignment:
| Q |
175 |
tttttgttgacattttgatttgattggtcagattgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacagga |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1228269 |
tttttgttgacattttgatttgattggtcagattgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacagga |
1228170 |
T |
|
| Q |
275 |
ggaatcattg |
284 |
Q |
| |
|
|||||||||| |
|
|
| T |
1228169 |
ggaatcattg |
1228160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 1243668 - 1243571
Alignment:
| Q |
187 |
ttttgatttgattggtcagattgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacaggaggaatcattg |
284 |
Q |
| |
|
||||||||||||| ||||| |||| |||| ||| |||||||||||||||| |||||||||||||||||| | ||| | |||||||||||| |||||| |
|
|
| T |
1243668 |
ttttgatttgatttatcagaatgtgacaaaagatgaaaacgcagcattggcggattattttgatgtgatatcaggggctagcacaggaggactcattg |
1243571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 1254367 - 1254270
Alignment:
| Q |
187 |
ttttgatttgattggtcagattgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacaggaggaatcattg |
284 |
Q |
| |
|
||||||||||||| ||||| |||| |||| ||| |||||||||||||||| |||||||||||||||||| | ||| | |||||||||||| |||||| |
|
|
| T |
1254367 |
ttttgatttgatttatcagaatgtgacaaaagatgaaaacgcagcattggcggattattttgatgtgatatcaggggctagcacaggaggactcattg |
1254270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 284
Target Start/End: Complemental strand, 1279182 - 1279100
Alignment:
| Q |
202 |
tcagattgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacaggaggaatcattg |
284 |
Q |
| |
|
||||||||||||||| ||| |||| |||||| |||| |||||||||||||||||||| ||||| || || |||||| |||||| |
|
|
| T |
1279182 |
tcagattgtgtcaaaagatgaaaaagcagcactggcagattattttgatgtgatagcagggacaagtactggaggactcattg |
1279100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 284
Target Start/End: Complemental strand, 1201174 - 1201098
Alignment:
| Q |
208 |
tgtgtcaaatgataaaaacgcagcattggctgattattttgatgtgatagcggggaccagcacaggaggaatcattg |
284 |
Q |
| |
|
||||||||||||| ||| |||||| | || |||||||||||||||||| | ||||| ||||| |||||| |||||| |
|
|
| T |
1201174 |
tgtgtcaaatgatgaaacggcagcacttgcagattattttgatgtgataacagggactagcactggaggactcattg |
1201098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University