View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2386_low_4 (Length: 277)

Name: NF2386_low_4
Description: NF2386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2386_low_4
NF2386_low_4
[»] chr7 (2 HSPs)
chr7 (5-110)||(5502896-5503001)
chr7 (134-257)||(5503017-5503137)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 5502896 - 5503001
Alignment:
5 attttctaaaatttcctttcaaaaagaaaactcattttctaaaataataaacaatttgaaacaattaaatattctgaatattgtgacggtactagtagca 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5502896 attttctaaaatttcctttcaaaaagaaaactcattttctaaaataataaacaatttgaaacaattaaatattctgaatattgtgacggtactagtagca 5502995  T
105 gtactg 110  Q
    ||||||    
5502996 gtactg 5503001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 134 - 257
Target Start/End: Original strand, 5503017 - 5503137
Alignment:
134 gttgaaatagaggtactgtttatttatatgaaatggatggagtatggagtactacaatatttactatttttcagttttggttcccaggaaatttttgtca 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||| ||||||||    
5503017 gttgaaatagaggtactgtttatttatatgaaatggatggagtatggagtac---aatatttactatttttcagttttggttcccaggaaaattttgtca 5503113  T
234 gattgaatagcatcttggaaggtg 257  Q
    ||||||||||||||||||||||||    
5503114 gattgaatagcatcttggaaggtg 5503137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University