View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2386_low_8 (Length: 246)
Name: NF2386_low_8
Description: NF2386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2386_low_8 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 32988688 - 32988461
Alignment:
| Q |
19 |
acgtgttgaagtaacaatggacggtggtgaaacatggcaagtatgcacattggaccattcagaaaaaccaaacaagtacggtaagtactggtgctggtgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988688 |
acgtgttgaagtaacaatggacggtggtgaaacatggcaagtatgcacattggaccattcagaaaaaccaaacaagtacggtaagtactggtgctggtgc |
32988589 |
T |
 |
| Q |
119 |
ttttggtccttggaagttgaagtgttggaccttctaggagccaaggatattgctgtacgagcttgggatgagtccctcaacacccaacctcagaacctca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988588 |
ttttggtccttggaagttgaagtgttggaccttctaggagccaaggatattgctgtacgagcttgggatgagtccctcaacacccaacctcagaacctca |
32988489 |
T |
 |
| Q |
219 |
tttggaatctcatggcaagtgcacatac |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
32988488 |
tttggaatctcatggcaagtacacatac |
32988461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 26 - 187
Target Start/End: Complemental strand, 32960195 - 32960034
Alignment:
| Q |
26 |
gaagtaacaatggacggtggtgaaacatggcaagtatgcacattggaccattcagaaaaaccaaacaagtacggtaagtactggtgctggtgcttttggt |
125 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |||||| ||| ||| ||||||| ||| || || || || ||||| ||||||||||||| |
|
|
| T |
32960195 |
gaagtgacgatggacggtggtgaaacatggcaagtatgcaaattggagcatcaagagaaaccaagcaaatatggaaaatattggtgttggtgcttttggt |
32960096 |
T |
 |
| Q |
126 |
ccttggaagttgaagtgttggaccttctaggagccaaggatattgctgtacgagcttgggat |
187 |
Q |
| |
|
| || || ||||||||||| ||| || | |||||||| || ||||| ||||| || |||||| |
|
|
| T |
32960095 |
ctttagaggttgaagtgttagacttttttggagccaaagagattgcagtacgtgcatgggat |
32960034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 29 - 226
Target Start/End: Complemental strand, 24863693 - 24863496
Alignment:
| Q |
29 |
gtaacaatggacggtggtgaaacatggcaagtatgcacattggaccattcagaaaaaccaaacaagtacggtaagtactggtgctggtgcttttggtcct |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||||||||| |||||||||||| || || || || || ||||| |||||||||||||| |
|
|
| T |
24863693 |
gtaacaatggacggtggagaaacatggcacgtgtgcacattggaccatccagaaaaaccaacaaaatatggaaaatattggtgttggtgcttttggtctc |
24863594 |
T |
 |
| Q |
129 |
tggaagttgaagtgttggaccttctaggagccaaggatattgctgtacgagcttgggatgagtccctcaacacccaacctcagaacctcatttggaat |
226 |
Q |
| |
|
|||||||||| ||| |||||||||| ||| ||||||| ||||||||| |||| ||||||||| | ||||||||||||||| | || |||||||||||| |
|
|
| T |
24863593 |
tggaagttgaggtgctggaccttcttggaaccaaggagattgctgtaagagcatgggatgaggcactcaacacccaacctgaaaatctcatttggaat |
24863496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University