View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2387_low_10 (Length: 279)
Name: NF2387_low_10
Description: NF2387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2387_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 81 - 273
Target Start/End: Original strand, 51960760 - 51960960
Alignment:
| Q |
81 |
aatattatgggagtacatattagtttgagtacaggcacttacctttgtctcccttgctagtgtgtctctttaatttagttatgtgattgtgat------- |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51960760 |
aatattatgggagtacatattagtttgagtacaggcacttacctttgtctcccttgctagcgtgtctctttaatttagttatgtgattgtgatgaactga |
51960859 |
T |
|
| Q |
174 |
-gatagagtaagatcaaaagtttactactcaccgtaattactgaatgaagaatgagtaatattattgttggatactacactgttgcatgtcaccagaaat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51960860 |
tgatagagtaagatcaaaagtttactactcaccgtaattactgaatgaagaatgagtaatattattgttggacactacactgttgcatgtcaccagaaat |
51960959 |
T |
|
| Q |
273 |
t |
273 |
Q |
| |
|
| |
|
|
| T |
51960960 |
t |
51960960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University