View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2387_low_10 (Length: 279)

Name: NF2387_low_10
Description: NF2387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2387_low_10
NF2387_low_10
[»] chr4 (1 HSPs)
chr4 (81-273)||(51960760-51960960)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 81 - 273
Target Start/End: Original strand, 51960760 - 51960960
Alignment:
81 aatattatgggagtacatattagtttgagtacaggcacttacctttgtctcccttgctagtgtgtctctttaatttagttatgtgattgtgat------- 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||           
51960760 aatattatgggagtacatattagtttgagtacaggcacttacctttgtctcccttgctagcgtgtctctttaatttagttatgtgattgtgatgaactga 51960859  T
174 -gatagagtaagatcaaaagtttactactcaccgtaattactgaatgaagaatgagtaatattattgttggatactacactgttgcatgtcaccagaaat 272  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
51960860 tgatagagtaagatcaaaagtttactactcaccgtaattactgaatgaagaatgagtaatattattgttggacactacactgttgcatgtcaccagaaat 51960959  T
273 t 273  Q
    |    
51960960 t 51960960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University