View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2388_low_16 (Length: 236)
Name: NF2388_low_16
Description: NF2388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2388_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 136 - 221
Target Start/End: Original strand, 30790947 - 30791032
Alignment:
| Q |
136 |
tagtatttctgtgttgattgtgtctaatttttacattttttcattcatggaaatacatgactattcatatcttcaatagacattct |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
30790947 |
tagtgtttctgtgttgattgtgtctaatttttacattttttcattcatggaaatacatgaatattcctatcttcaatagacattct |
30791032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43183038 - 43183083
Alignment:
| Q |
1 |
aattataataccatttatgatgataatgtaaattccactgctctta |
46 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43183038 |
aattataatactatttatgatgataatgtaaattccactgctctta |
43183083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Original strand, 43183096 - 43183128
Alignment:
| Q |
189 |
tacatgactattcatatcttcaatagacattct |
221 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43183096 |
tacatgactattcctatcttcaatagacattct |
43183128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University