View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2388_low_8 (Length: 306)
Name: NF2388_low_8
Description: NF2388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2388_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 13 - 126
Target Start/End: Complemental strand, 36373893 - 36373780
Alignment:
| Q |
13 |
aaggtgtgaaagttatcaaatgtgcagctctttcaagcacgaatggaaaattaactttcaaaaggaaggtagaattttcatagataagaaaatcattttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36373893 |
aaggtgtgaaagttatcaaatgtgcagctctttcaagcaccaatggaaaattaactttcaaaaggaaggtagaattttcatagataagaacatcattttt |
36373794 |
T |
 |
| Q |
113 |
tgatttggtatcct |
126 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36373793 |
tgatttggtatcct |
36373780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 204 - 306
Target Start/End: Complemental strand, 36373690 - 36373588
Alignment:
| Q |
204 |
attatcgaagatattattaaattgaatcacataataggcccttttccataagatattttgtgaaactttttaagtttgtacaagcgggttatcattcacg |
303 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||||||| |||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
36373690 |
attatcgaagatattattagattaaatcatataataggtcctttttcataagatattttgtgaaactttttaagcttgtacaagcaggttatcattcacg |
36373591 |
T |
 |
| Q |
304 |
gaa |
306 |
Q |
| |
|
||| |
|
|
| T |
36373590 |
gaa |
36373588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University