View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2388_low_9 (Length: 301)
Name: NF2388_low_9
Description: NF2388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2388_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 20 - 171
Target Start/End: Original strand, 42443090 - 42443241
Alignment:
| Q |
20 |
gaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatggacatggcgtagagtgggtatggggaatcgtatgttacggagttgtta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443090 |
gaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatggacatggcgtagagtgggtatggggaatcgtatgttacggagttgtta |
42443189 |
T |
|
| Q |
120 |
tcggatcggagatgggattcttgtgttgaattatccatttttggtggatggt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443190 |
tcggatcggagatgggattcttgtgttgaattatccatttttggtggatggt |
42443241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 287
Target Start/End: Original strand, 42443312 - 42443357
Alignment:
| Q |
242 |
tgaaggaagggcacgagccttaaaatctcaactgccttattcttct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443312 |
tgaaggaagggcacgagccttaaaatctcaactgccttattcttct |
42443357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University