View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2389_high_30 (Length: 239)
Name: NF2389_high_30
Description: NF2389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2389_high_30 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 11 - 239
Target Start/End: Complemental strand, 20175880 - 20175654
Alignment:
| Q |
11 |
cataggacaacgtagacagacacttatgatttttcattttagaaaattgatatannnnnnnctcnnnnnnntaatgtttatttttggggtcgcatgaatg |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
20175880 |
cataggacgacgtagacagacacttatgatttttcattttagaaaattgatatatttttttctcaaaaaaataatgtttatttttggggtcgcatgaatg |
20175781 |
T |
 |
| Q |
111 |
tctttttatctgggggatgtaaggttgtcggactgtgattggacagagaggacgtgtctttggtcttggcttgtctgagacacgtggcacattgggattt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20175780 |
tctttttatctgggg-atgtaaggttgtcggactgtgattggacagagaggacgtgt-tttggtcttggcttgtctaagacacgtggcacattgggattt |
20175683 |
T |
 |
| Q |
211 |
actgtgatgaagagaaattgtaggcactg |
239 |
Q |
| |
|
||||| | ||||| ||||||||||||||| |
|
|
| T |
20175682 |
actgttacgaagataaattgtaggcactg |
20175654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University