View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2389_high_34 (Length: 225)
Name: NF2389_high_34
Description: NF2389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2389_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 20175664 - 20175453
Alignment:
| Q |
1 |
tgtaggcactggccccccactcac----agtcactgcgtctgcaattcacaaatttcctttggttcttttctgcctaaaataaaatcaactgcgctgtcc |
96 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20175664 |
tgtaggcactggccccccactcactcacagtcacagcgtctgcaattcacaaatttcctttggttcttttctgcctaaaataaaatcaactgcgctgtcc |
20175565 |
T |
 |
| Q |
97 |
ttttccttcattatctcacaaacaaacacctctttcatctttgaaatgtgtaatattcaaccaacatttgatatgctataattatctatgcggtgtttgg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20175564 |
ttttccttcattatctcacaaacaaacacctctttcatctttcaaatgtgtaatattcaaccaacatttgatatgctataattatctatgcaatgtttgg |
20175465 |
T |
 |
| Q |
197 |
tttggcgttttt |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20175464 |
tttggcgttttt |
20175453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University