View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2389_high_9 (Length: 431)
Name: NF2389_high_9
Description: NF2389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2389_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 236 - 360
Target Start/End: Complemental strand, 8140480 - 8140356
Alignment:
| Q |
236 |
caggtttgattaggcagccaaaatatggtcatctgaaggagcttcatagagctatcaagatgtgcgagcgagctttggtttcaaccgacccaattgttac |
335 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||| ||||||||||||| ||||| |||||||| ||| |||||| |||||||||||||| ||||||| |
|
|
| T |
8140480 |
caggtttaattaggcaaccaaagtatggtcatctaaaggagcttcataaggctattaagatgtgtgagaaagctttaatttcaaccgacccagttgttac |
8140381 |
T |
 |
| Q |
336 |
ttcattagggagctcccaacaggtt |
360 |
Q |
| |
|
|||||||| | || |||||||||| |
|
|
| T |
8140380 |
ctcattaggaaacttccaacaggtt |
8140356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 8140747 - 8140687
Alignment:
| Q |
20 |
ggaggcccttttatatctactagttatgactatgatgctccactagatgaatatggtgaga |
80 |
Q |
| |
|
||||| |||||||| |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140747 |
ggaggtccttttatcactaccagctatgactatgatgctccactagatgaatatggtgaga |
8140687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 237 - 294
Target Start/End: Original strand, 52647707 - 52647764
Alignment:
| Q |
237 |
aggtttgattaggcagccaaaatatggtcatctgaaggagcttcatagagctatcaag |
294 |
Q |
| |
|
||||||| | ||||| ||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
52647707 |
aggtttggtcaggcatccaaaatatagtcatttgaaggagcttcataaagctatcaag |
52647764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University