View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2389_low_30 (Length: 251)
Name: NF2389_low_30
Description: NF2389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2389_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 22338847 - 22339069
Alignment:
| Q |
16 |
ctaagtgcagcatcaaccatgtttcataatttttgcctcaacatggcaaaagatgtcgaagtggttgttgcgtctatagagtatcgtcttgcaccagaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22338847 |
ctaagtgcagcatcaaccatgtttcataatttttgcctcaacatggcaaaagatgtcgaagtggttgttgcgtctatagagtatcgtcttgcaccggaac |
22338946 |
T |
 |
| Q |
116 |
atagacttccagctgcatatgatgatgcagtggaagctttgcactggatcaaagctaatctgtcaaatgaccggttcaaaaaccatgttgattattctaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||| | ||||||||||||||||||||| |
|
|
| T |
22338947 |
atagacttccagctgcatatgatgatgcagtggaagctctgcactggatcaaagctaatctgtcagatgactggttgagaaaccatgttgattattctaa |
22339046 |
T |
 |
| Q |
216 |
tgtttttctcatgggtagtagtg |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22339047 |
tgtttttctcatgggtagtagtg |
22339069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University