View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2389_low_33 (Length: 240)
Name: NF2389_low_33
Description: NF2389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2389_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 30467169 - 30467004
Alignment:
| Q |
15 |
gatctaaagatctaaa-tataacgtccgacagaaaaggcatcttggctacgggacaggatt-gcaa-gtgtgtgtaataagcttttgaaagagacgttac |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30467169 |
gatctaaagatctaaaatataacgtccgacagaaaaggcatcttggctacgggacaggatttgcaaagtgtgtgtaataagcttttgaaagagacgttac |
30467070 |
T |
 |
| Q |
112 |
attacatgtatttctagacctagtagatatgcgtggataggttaagaatcacaatatttttcttca |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30467069 |
attacatgtatttctagacctagtagctatgcgtggataggttaagaatcacaatatttttcttca |
30467004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 30466181 - 30466131
Alignment:
| Q |
169 |
ttttcttcaagatgatatggactttaaaagggaacaacaaattagggaaatac |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30466181 |
ttttcttcaagatgat--ggactttaaaagggaacaacaaattagggaaatac |
30466131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University