View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2390_low_1 (Length: 250)
Name: NF2390_low_1
Description: NF2390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2390_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 5500321 - 5500400
Alignment:
| Q |
154 |
tatagaacatagggatgtttaaatgtatttttacatttctatatatgatttgtttactgatattcttataagtatttact |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5500321 |
tatagaacatagggatgtttaaatgtatttttccatttctatatatgatttgtttactgatattcttataactatttact |
5500400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 26 - 82
Target Start/End: Original strand, 5500240 - 5500296
Alignment:
| Q |
26 |
ttattaaagttactttttgaatagtttatccgaacatttaatgctagagttatattt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5500240 |
ttattaaagttactttttgaatagtttatccgaacatttaatgctagagttatattt |
5500296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University