View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_high_14 (Length: 390)
Name: NF2391_high_14
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 69 - 375
Target Start/End: Complemental strand, 20713281 - 20712975
Alignment:
| Q |
69 |
ccgaggctgaagtatcagagaatgggaggtagcgttccttcgttgttagctactgatgccgcgtcttgtgtttcggttgctgaaaggatgatcgcgcttg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713281 |
ccgaggctgaagtatcagagaatgggaggtagcgttccttcgttgttagctactgatgccgcgtcttgtgtttcggttgctgaaaggatgatcgcgcttg |
20713182 |
T |
|
| Q |
169 |
gtactcaggctgggactattcatattcttgattttctcgggaatcaggtttgttagcattgcattgattcgttgtttatcgtcgaaagttcaataattgt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713181 |
gtactcaggctgggactattcatattcttgattttctcgggaatcaggtttgttagcattgcattgattcgttgtttatcgtcgaaagttcaataattgt |
20713082 |
T |
|
| Q |
269 |
ggtgaatttgtagtattttgattaaattggagttagttagatcaaatttgaagaagtaattgatcaaatcaaagtatgtttagattaagaaaaattattg |
368 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713081 |
ggtgaatttatagtattttgattaaattggagttagttagatcaaatttgaagaagtaattgatcaaatcaaagtatgtttagattaagaaaaattattg |
20712982 |
T |
|
| Q |
369 |
tgttttt |
375 |
Q |
| |
|
||||||| |
|
|
| T |
20712981 |
tgttttt |
20712975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University