View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_high_35 (Length: 250)
Name: NF2391_high_35
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 51378915 - 51378676
Alignment:
| Q |
3 |
tcaccatgtcctgttttttgtttgttatttaggatcatgccgggcatatatttggtgttgactcaactccaatgatagaaaagttggagcagtacaataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378915 |
tcaccatgtcctgttttttgtttgttatttaggatcatgccgggcatatatttggtgttgactcaactccaatgatagaaaagttggagcagtacaataa |
51378816 |
T |
|
| Q |
103 |
ctatttagaggtcagttttggtaattactaattatgtttggtatgtggtctgctctacatcgttgtccgttccttttcagttttcactatgttaagtggc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378815 |
ctatttagaggtcagttttggtaattactaattatgtttggtatgtggtctactctacatcgttgtccgttccttttcagttttcactatgttaagtggc |
51378716 |
T |
|
| Q |
203 |
actttttgtgttaactagtttttctttcatggcctatgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51378715 |
actttttgtgttaactagtttttcttttatggcctatgct |
51378676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University