View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_high_36 (Length: 250)
Name: NF2391_high_36
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 26922380 - 26922620
Alignment:
| Q |
1 |
aacatgtatcgactatcttaatccatattaacttaatcaatagacaagaaattgtaaaaacaatgcctggtatgtgatctaaaaatagaaatagtttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
26922380 |
aacatgtatcgactatcttaatccatattaacttaatcaatagacaagaaattgtaaaaacaatgcctagtatgtgatcttaaaatagaaatagtttgct |
26922479 |
T |
|
| Q |
101 |
accaattggtcttctttgaataaacgtg--tatatataactttatcgtacattattttgaaatttattggagttttttaaatcaagcattggnnnnnnnn |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26922480 |
accaattggtcttctttgaataaacgtgtatatatataactttaacgtacattattttgaaatttaatggagttttttaaatcaagcattgg-aaaaaaa |
26922578 |
T |
|
| Q |
199 |
nttgcattagaagctggcaaaaacattaacttaatccctatg |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26922579 |
attgcattagtagctggcaaaaacattaacttaatccctatg |
26922620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University