View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_high_41 (Length: 203)
Name: NF2391_high_41
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 52628327 - 52628171
Alignment:
| Q |
1 |
tccttgtttaatttgtttgtgtgaattgtgatagttactaccattgctttcggtgttactattaatatattaaccgttaaactctcttaatgcgctatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52628327 |
tccttgtttaatttgtttgtgtgaattgtgatagttactaccattgctttcggtgttacaattaatatattaaccgttaaactctcttaatgcgctatga |
52628228 |
T |
|
| Q |
101 |
caatgaaacatttgtatatcataattttgtttttataaaattagcttatttttgttc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52628227 |
caatgaaacatttgtatatcataattttgtttttataaaattagcttatttttgttc |
52628171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University