View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_high_42 (Length: 203)
Name: NF2391_high_42
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_high_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 9480188 - 9480046
Alignment:
| Q |
15 |
aagaatatgggaagaagaaaacacaaggaggtcaaatcaaatatgtaacaatttatcattgctctcttaattttcttcttgattgggaagaaaacacaat |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
9480188 |
aagaaaatgggaagaagaaaacacaaggaggtcaaatcaaatatgtaataatttatcattactctcataattttcttcttaattaggaagaaaacacaat |
9480089 |
T |
|
| Q |
115 |
ttcgatgtcgt----tttgtaggaaatattggaccatatattc |
153 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
9480088 |
ttcgatgtcgtttaatttgtaggcaatattggaccatatattc |
9480046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University