View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2391_low_10 (Length: 435)

Name: NF2391_low_10
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2391_low_10
NF2391_low_10
[»] chr2 (1 HSPs)
chr2 (96-421)||(41236481-41236805)
[»] chr6 (1 HSPs)
chr6 (366-420)||(20686875-20686929)
[»] chr4 (1 HSPs)
chr4 (366-421)||(23384951-23385006)
[»] chr7 (1 HSPs)
chr7 (371-413)||(40197340-40197382)


Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 96 - 421
Target Start/End: Original strand, 41236481 - 41236805
Alignment:
96 tcttctgtgattttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatactcagactcaaagtttagttcactgcgtgtttaccaa 195  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
41236481 tcttctgtgactttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatacttagactcaaagtttagttcactgcatgtttaccaa 41236580  T
196 agtttactaaaatttgagtttacagttagatcaacttgaaatagatcattagactcatggaatcgtagttaatttgtggttttaacaattattcgtgtgt 295  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41236581 agtttactaaaatttgagtt-acagttagatcaacttgaaatagatcattagactcatggaatcgtagttaatttgtggttttaacaattattcgtgtgt 41236679  T
296 atctgtgttatgtgaatatgaaacataaattcaagttttatagcactagtgacaagaaattatcctaaatgtttgcatacccttttgctttcatccatgt 395  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41236680 atccgtgttatgtgaatatgaaacataaattcaagttttatagcactagtgacaagaaattatcctaaatgtttgcatacccttttgctttcatccatgt 41236779  T
396 caactttgttgccaaccagtattttg 421  Q
    ||||||||||||||||||||||||||    
41236780 caactttgttgccaaccagtattttg 41236805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 366 - 420
Target Start/End: Complemental strand, 20686929 - 20686875
Alignment:
366 gtttgcatacccttttgctttcatccatgtcaactttgttgccaaccagtatttt 420  Q
    |||||||||| |||| | |||||||||| ||||||||||| ||||||||||||||    
20686929 gtttgcatacactttagatttcatccatatcaactttgtttccaaccagtatttt 20686875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 366 - 421
Target Start/End: Original strand, 23384951 - 23385006
Alignment:
366 gtttgcatacccttttgctttcatccatgtcaactttgttgccaaccagtattttg 421  Q
    |||||||||||||||||||||| ||||| ||  ||||||| || ||||||||||||    
23384951 gtttgcatacccttttgctttcgtccatatctgctttgttccctaccagtattttg 23385006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 371 - 413
Target Start/End: Complemental strand, 40197382 - 40197340
Alignment:
371 catacccttttgctttcatccatgtcaactttgttgccaacca 413  Q
    ||||||| ||||||||||||||||||| |||||||||| ||||    
40197382 catacccgtttgctttcatccatgtcagctttgttgcccacca 40197340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University