View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_low_22 (Length: 354)
Name: NF2391_low_22
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2778777 - 2778534
Alignment:
| Q |
1 |
agaaagcgtgtgcaattgaaagagaaagagtgtccctacactagacagacatagacatagtcatagacaaacaaaacccagaagaagaagaagcagcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2778777 |
agaaagcgtgtgcaattgaaagagaaagagtgtccctacactagacagacatagacatagacatagacaaacaaaacccagaagaagaag---cagcagg |
2778681 |
T |
 |
| Q |
101 |
taggtaagttcgtgaagacagttgttaatgttttttctgttctttctgacactatcacttattaaggcacgtcatgtcttcttcatcaaatcgtgcacgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2778680 |
taggtaagttcgtgaagacagttgttaatgttttttctgttctttctgacactatcacttattaaggcacgtcatgtcttcttcatcaaatcgtgcacgc |
2778581 |
T |
 |
| Q |
201 |
actaccacgtcagttttatcaatttaaagatattactacaaatttct |
247 |
Q |
| |
|
|||||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
2778580 |
actaccacgtcacttttatcaatttataaatattactacaaatttct |
2778534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University