View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2391_low_26 (Length: 326)

Name: NF2391_low_26
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2391_low_26
NF2391_low_26
[»] chr7 (1 HSPs)
chr7 (256-307)||(28032279-28032330)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 307
Target Start/End: Complemental strand, 28032330 - 28032279
Alignment:
256 atgacctaaatcctagccatcttataacatgttaacatgtataggcatgaat 307  Q
    ||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
28032330 atgacctaaatcctagccatcttataacatgttaatatgtataggtatgaat 28032279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University