View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_low_30 (Length: 298)
Name: NF2391_low_30
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 26921887 - 26922165
Alignment:
| Q |
19 |
ggttcttctctaaacggaaaaaagcctcttcggagctgctttttgctacaagaccgcatcttgatcttacgaccgcttcctgaatgttgtaacacaccgg |
118 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26921887 |
ggttcttctctaagctgaaaaaagcctcttcggagctgctttttgctacaagaccgcatcttggtcttacgactgcttcctgaatgttgtaacacaccgt |
26921986 |
T |
 |
| Q |
119 |
tttcaaggccatttcaaggtcacgaacaaccacacaatctcgaagccctcaaacagaatgtgaaacttctcactgaaaagataaaattccgtctttgtag |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
26921987 |
ttt-aaggccatttcaaggtcacgaacaaccacacaatctcgaagccctcaaacagaatgtgaaacttctcattgaaaagataaaattctgtccttgtag |
26922085 |
T |
 |
| Q |
219 |
ttttattgtaacaaaataatggctttacaatttcacattcagtttgaggacttccggatggtttggttgttggtgacttt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26922086 |
ttttattgtaacaaaataatggctttacaatttcacattcagtttgaggacttccagatggtttggttgttggtggcttt |
26922165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University