View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_low_31 (Length: 294)
Name: NF2391_low_31
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 103 - 275
Target Start/End: Original strand, 4097261 - 4097433
Alignment:
| Q |
103 |
ttgaagggaacttaattatatcactttgcaggaaaaatgcagaagccattaccagagttgttaaaggagtatgatctaccaataggaatctttcctcgtg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4097261 |
ttgaagggaacttaattatatcactttgcaggaaaaatgcagaagccattaccagagttgttaaaggagtatgatctaccaataggaatctttcctcgtg |
4097360 |
T |
 |
| Q |
203 |
atgcaacaaactacgaatttaacgaagagacggggaagcttcaagtcttcattcctcaggtctgcgaagtagg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4097361 |
atgcaacaaactacgaatttaacgaagagacgggaaagcttgaagtcttcatccctcaggtctgcgaagtagg |
4097433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 4096104 - 4096183
Alignment:
| Q |
1 |
cggaaccaaatggttggtcaacaaagtaaaaggtttgtatttcctatttccatatgttgctcaaacatttatcttttcaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4096104 |
cggaaccaaatggttggtcaacaaagtaaaaggtttctatttcctatttccatatgttgctcaaacatctatcttttcaa |
4096183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 127 - 218
Target Start/End: Complemental strand, 25796905 - 25796814
Alignment:
| Q |
127 |
tttgcaggaaaaatgcagaagccattaccagagttgttaaaggagtatgatctaccaataggaatctttcctcgtgatgcaacaaactacga |
218 |
Q |
| |
|
||||||||||| ||||| || |||||| |||||||| | |||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
25796905 |
tttgcaggaaagatgcaaaaaccattaacagagttgctgaaggagtatgatctaccaataggaatctttccccgtgacgcaacaaactacga |
25796814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 43
Target Start/End: Complemental strand, 25797209 - 25797168
Alignment:
| Q |
2 |
ggaaccaaatggttggtcaacaaagtaaaaggtttgtatttc |
43 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
25797209 |
ggaaccaaatggctcgtcaacaaattaaaaggtttgtatttc |
25797168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University