View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_low_33 (Length: 277)
Name: NF2391_low_33
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 22415035 - 22414766
Alignment:
| Q |
1 |
gcagatagagttgttttgaagaggcctacttctctgattggcttattggcatgaagctaaagcatcattatgt-----tgtttacttccttacccttaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22415035 |
gcagatagagttgttttgaagaggcctacttctctgattggcttattggcatgaagctaaagcatcattatgtggtgttgtttacttccttacccttaaa |
22414936 |
T |
 |
| Q |
96 |
ctcaatcatccaagataagtagaggttcatacgactcttctcgtacacac--atcgnnnnnnnntatacattgaaactcatgacaaaataagtaaaagaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22414935 |
ctcaatcatccaagataagtagaggttcatacgactcttctcgtacacacatatcgaaaaaaaatatacattgaaactcatgacaaaataagtaaaagaa |
22414836 |
T |
 |
| Q |
194 |
ctatgcaggataaattcaagtagcaattactttgtcataaccgtgacttttatcatttccattatattct |
263 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22414835 |
ctatgcaagataaattcaagtagcaattactttgtcataaccgtgacttttatcatttccattatattct |
22414766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University