View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2391_low_37 (Length: 258)

Name: NF2391_low_37
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2391_low_37
NF2391_low_37
[»] chr5 (1 HSPs)
chr5 (13-241)||(8211940-8212168)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 241
Target Start/End: Original strand, 8211940 - 8212168
Alignment:
13 aaaataagctcagtggaaaaatacctgatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt 112  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8211940 aaaataagctcagtggaaaaatacctaatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt 8212039  T
113 tccggcgtctttggttcagatttcaatgaggaacaataatttaagcggtggtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
8212040 tccggcgtctttggttcagatttcaatgaggaacaataatttaagtggtagtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat 8212139  T
213 ttcagttcaaacaaaattaatggctatgt 241  Q
    ||||||||||||||||| |||||||||||    
8212140 ttcagttcaaacaaaatcaatggctatgt 8212168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University