View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2391_low_46 (Length: 236)

Name: NF2391_low_46
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2391_low_46
NF2391_low_46
[»] chr4 (1 HSPs)
chr4 (1-101)||(196014-196114)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 196114 - 196014
Alignment:
1 acataactgaccaaataaaaataataaagttgaattagtaatcagtatctttcctacaccggataatatttaaagtaaaatatcaataaattctgcacat 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
196114 acataactgaccaaataaaaataagaaagttgaattagtaatcagtatctttcctacaccggacaatatttaaagtaaaatatcaataaattctgcacat 196015  T
101 a 101  Q
    |    
196014 a 196014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University