View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2391_low_47 (Length: 234)
Name: NF2391_low_47
Description: NF2391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2391_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 39836477 - 39836667
Alignment:
| Q |
16 |
ttaagcaaatttccaaaattattattctccttataattttannnnnnnnnaattgttgcgaccataaacatttcggggctttatattgtccttcataatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39836477 |
ttaagcaaatttccaaaattattattctccttataatt--attttttaaaaattgttgcgacaataaacatttcggggctttatattgtccttcataatt |
39836574 |
T |
|
| Q |
116 |
gtatagca--agccggcaagattgaaagttttgaaattctgtttgtggaagtgcaagggagtttcacattttgggccatcaagtgaaactcgt |
206 |
Q |
| |
|
|||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39836575 |
gtatagcagcaaccagcaagattgaaagttttgaaattctgtttgtggaagtgcaagggagtttcacgttttgggccatcaagtgaaactcgt |
39836667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University