View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2392_low_3 (Length: 321)
Name: NF2392_low_3
Description: NF2392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2392_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 114 - 238
Target Start/End: Original strand, 11343793 - 11343914
Alignment:
| Q |
114 |
gccacatgtcacgcagctaagagttggg-taaatggaggtttcataaatggagggaagatgaattccatatacacacaatagagagagaaagaaagaaca |
212 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
11343793 |
gccacatgtcacccatataagagttggggtaaatggaggtttcataaatggagggaagatgaactccatatacacacaat----agagaaagagagaaca |
11343888 |
T |
 |
| Q |
213 |
tgaataacaaagatggctaaggtttc |
238 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
11343889 |
tgaataacaaagacggctaaggtttc |
11343914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11343680 - 11343731
Alignment:
| Q |
1 |
agaagaaaggtcgtgtgaagtttgaaccagaagagtaagtgcgtgtgacttc |
52 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11343680 |
agaagaaaggtcgtgtgaagtttgaactagaagagtaagtgcgtgtggcttc |
11343731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University