View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2392_low_5 (Length: 304)
Name: NF2392_low_5
Description: NF2392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2392_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 34 - 290
Target Start/End: Original strand, 44694032 - 44694291
Alignment:
| Q |
34 |
aatggatactttgtgtttattacaaagtgggattcctggtatagttcctttaatcacttctattactgcaaccactactacttcacgtgccaatgatcac |
133 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
44694032 |
aatggttactttgtgtttattacaaagtgggattcctggtatagttcctttaatcacttctattagtgcaactactactacttcacgtgccaatgatcac |
44694131 |
T |
 |
| Q |
134 |
gttcacgtgcatcaatctcacgtaaccacagtgaggcgatcaaacaagtcctccatgttttccagattcataggtagctccgccagaaacaattgcctt- |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694132 |
gttcacgtgcatcaatctcacgtaaccacagtgaggcgatcaaacaagtcctccatgttttccagattcataggtagctccgccagaaacaattgccttg |
44694231 |
T |
 |
| Q |
233 |
--gcagtcaacgacgcctttaccgcggagaatgcagacagagctgtgaaagaaggagatg |
290 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44694232 |
cagcagtcaacgacgccttcaccgcggagaatgcagacagaactgtgaaagaaggagatg |
44694291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University