View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2393-Insertion-7 (Length: 73)
Name: NF2393-Insertion-7
Description: NF2393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2393-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 50238489 - 50238430
Alignment:
| Q |
14 |
atacaaaaagagcttcttatttgacatacagacttctcccctttgaataggtattgtgca |
73 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50238489 |
atacaaaaagagcttcttattcgacatatagacttctcccctttgaataggtattgtgca |
50238430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University