View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2393_high_5 (Length: 237)
Name: NF2393_high_5
Description: NF2393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2393_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 48720713 - 48720492
Alignment:
| Q |
1 |
atggattattgcatgtaggtggtcctgaattgtttccactactagcagttcccgtgtctcctgaattgtctcttgaagcattagtcactccttaaactgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48720713 |
atggattattgcatgtaggtggtcctgaattgtttccactactagcacttcccgtgtctcctgaattgtctcttgaagcattagtcactccttaaactgc |
48720614 |
T |
 |
| Q |
101 |
gatggagagttcaatcatctgctttttagagcagtctgcatagctgtcatctcttcaattgaatccttcaatgttgctgacaaatctgagccaccaatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48720613 |
gatggagagttcaatcatctgctttctagagcagtctgcatagctgtcatctcttcaattaaatccttcaatgttgctgacaaatctgagccaccaatgc |
48720514 |
T |
 |
| Q |
201 |
tggcccgtgataccaagttgtt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48720513 |
tggcccgtgataccaagttgtt |
48720492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 48721122 - 48721009
Alignment:
| Q |
1 |
atggattattgcatgtaggtggtcctgaattgtttccactactagcagttcccgtgtctcctgaattgtctcttgaagcattagtcactccttaaactgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48721122 |
atggattattgcatgtaggtggtcctgaattgtttccactactagcacttcccgtgtctcctgaattgtctcttgaagcattagtcactccttaaactgc |
48721023 |
T |
 |
| Q |
101 |
gatggagagttcaa |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48721022 |
gatggagagttcaa |
48721009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University