View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2393_low_5 (Length: 258)
Name: NF2393_low_5
Description: NF2393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2393_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 141 - 243
Target Start/End: Complemental strand, 28003851 - 28003749
Alignment:
| Q |
141 |
gaatactaagtgcatcactcaattaatcaaaaacatatttcttttttactcaattaatgtatatgcctcactaactcatcttagtgtactaatagagtct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28003851 |
gaatactaagtgcatcactcaattaatcaaaaacatatttcttttttactcaattaatgtatatgcctcactaactcatcttagtgtactaatagagtct |
28003752 |
T |
|
| Q |
241 |
ata |
243 |
Q |
| |
|
||| |
|
|
| T |
28003751 |
ata |
28003749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 141 - 243
Target Start/End: Complemental strand, 28061153 - 28061051
Alignment:
| Q |
141 |
gaatactaagtgcatcactcaattaatcaaaaacatatttcttttttactcaattaatgtatatgcctcactaactcatcttagtgtactaatagagtct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28061153 |
gaatactaagtgcatcactcaattaatcaaaaacatatttcttttttactcaattaatgtatatgcctcactaactcatcttagtgtactaatagagtct |
28061054 |
T |
|
| Q |
241 |
ata |
243 |
Q |
| |
|
||| |
|
|
| T |
28061053 |
ata |
28061051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University