View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2394_high_5 (Length: 204)

Name: NF2394_high_5
Description: NF2394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2394_high_5
NF2394_high_5
[»] chr7 (1 HSPs)
chr7 (19-190)||(47728893-47729064)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 47728893 - 47729064
Alignment:
19 ggatagaaattaccagccgaagaagtcatatgcaacactgtttgcttgagtcatgtgccatagctcccacattgttaatttatcaggcacttcacgagca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47728893 ggatagaaattaccagccgaagaagtcatatgcaacactgtttgcttgagtcatgtgccatagctcccacattgttaatttatcaggcacttcacgagca 47728992  T
119 tacttactgaacattagttccaaatttgccggaatgaacctaaaaaatattgttttagcaacagtacttgat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47728993 tacttactgaacattagttccaaatttgccggaatgaacctaaaaaatattgttttagcaacagtacttgat 47729064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University