View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2394_low_5 (Length: 276)
Name: NF2394_low_5
Description: NF2394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2394_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 52049730 - 52049475
Alignment:
| Q |
1 |
gataatggaaagtgaagaacaagtagagctatctttcactagaacatggaatttatctcttgaaggaaagcttgcgccactcaatattgataaaaggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049730 |
gataatggaaagtgaagaacaagtagagctatctttcactagaacatggaatttatctcttgaaggaaagcttgcgccactcaatattgataaaaggttt |
52049631 |
T |
|
| Q |
101 |
attggttaccctgctgctgctttaggagcaaactttaaattagttcaagt-aaataaataataaaaatgaggaaaatctatacatacgtaggtttataat |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049630 |
attggttaccctgc---tgctttaggagcaaactttaaattagttcaagtaaaataaataataaaaatgaggaaaatctatacatacgtaggtttataat |
52049534 |
T |
|
| Q |
200 |
gcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52049533 |
gcttcgtggttcatccggattctacacgtatgccatttacgatcatttgaaggaatggc |
52049475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University