View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2394_low_8 (Length: 219)
Name: NF2394_low_8
Description: NF2394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2394_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 42681151 - 42681330
Alignment:
| Q |
18 |
aaatcttttagtgaaagtgtcttaaaatccgttgatcttgtctttcccctttctcaactgtcttaannnnnnnnn--atggaagttgcaattagtttgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
42681151 |
aaatcttttagtgaaagtgtcttaaaatccgttgatcttgtctttcccctttctcaactgtcttaatttttttttttatggaagttgcaattggtttgat |
42681250 |
T |
|
| Q |
116 |
tcagggaccttctccggtatatatcaatatatatgcttgtgattttgtcatttatttttataactcaggaactactagta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42681251 |
tcagggaccttctccggtatatatcaatatatatgcttgtgattttgtcatttatttttataactcaggaactactagta |
42681330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University